STEB: Pokročilý

Pokročilý

V tejto kategórii súťažíš, ak si sa do STEB-u zapojil/a už aj vlani, alebo ak študuješ v poslednom ročníku strednej školy a do STEB-u sa zapájaš prvý krát. 

Séria 1: Výskum genomiky prirodzených populácií

Gény sú pre evolučných biológov mimoriadne dôležitým nástrojom: umožňujú nám pochopiť, ako sú si druhy podobné alebo ako sa navzájom líšia. Pomáhajú tiež odhaliť vzájomné vzťahy medzi druhmi, ktoré nemusia byť zrejmé z vonkajších znakov. V prvej sérii sa spolu s Dášou, mladou vedkyňou a autorkou tohto článku, zúčastníme na výskumnom projekte, ktorý realizovala s cieľom lepšie pochopiť nezvyčajnú populáciu drobných spevavcov na Urale.

Riešenia zadaní 1. série odovzdajte najneskôr do polnoci 30. októbra.

STEB_SK_Year7_Advanced1.pdf
STEB_7B_SK_Q.pdf
STEB_SK_Year7_AdvancedS1_project.pdf

Sekvencie na projekt

DNA na PCR a sekvenovanie

ATGTTCATTAACCGATGACTATTCTCTACCAATCACAAAGACATTGGTACCCTGTATTTACTATTTGGCGCCTGGGCAGGAATAGTAGGTACCGGTCTAAGTTTGTTGATTCGTGCTGAATTAGGTCAACCTGGCACACTTATCGGAGACGACCAGCTTTATAATGTTCTAGTGACAGCTCATGCCTTCGTAATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGTTTTXXXXXXXXXXXXXXXXXXXXAATAATTGGAGCTCCTGACATAGCATCCCGTCTAAACAACATAAGCTTCTGACTACTCCCCCCTTCCTTTCTACTACTAATAGCATCCTCTTCAATGAGGCCGGCGCAGGTACAGGCTGAACTGTTTACCCTCCTCTAGCCGGAAATCTGGCACAAATTTGCAGGAGCCTCAGTAGACCTTACCATTTTCTCTCTACATTTAGCCGGTGTATCTTCAATCCTTGGAGCTATTAACTTCATCACAACTATTATCAATATAAAACCACCCGCTATAACTCAATACCAAACACCCCTCTTCGTCTGATC


Vzorka 1-5, Inzulín

Sample 1: AGTCCTCTGGGACCAGCTGTGTTCCCAGGCCCCCGGCAACGAGGTCCTCACCCCCCGCCATGGCCCTGTGGACGCGCCTCCTGCCCCTGCTGGCCCTGCTGGCCCTCTGGGCGCCCGAAAAGGCCCAGGCCTTCGTGAACCAGCACCTGTGCGGCTCCCACCTGGTGGACTGTACCTGGTGTGCGGGGAGCGCGGCTTCTTCTACACGCCCAAGGCCCGTCGGGAGGCGGAGAACCCTCAGGCAGGTGCCGTGGAGCTGGGCGGAGGCCTGGGCGGCCTGCAGGCCCTGGCGCTGGAGGGGCACAACACACGCAGAAGCGTGGCATCGTGGAGCAGTGCTGCACCAGCATCTGTTCCCTCTACCAGCTGGAGAACTACTGCAACTAGGCCGCCCCTGAGGGCGCCTGCTGCTCCCCGCACCCCCCCCCCCAATAAA


Sample 2:

AGCCCCCCGCCCTCAGGACCGGCTGCATTCGAGGCTGCCAGCAAGCAGGTCCTCGCAGCCCCGCCATGGCCCTGTGGACACGCCACCGGCTGCATTCGAGGCTGCCAGCAAGCAGCCCCCGCTGTCGCCAGGTCCTCGCAGCCCCGCCATGGCCCTGTGGACACGCCTCTGTGCCAGCGTCTGCTCGCTCTACCAGCTGGAGAACTACTGTAACTAGGCCTGCCCCCGACACCAATAAACCCCTTGACGAGCCGGTGGAGGCGCTGTACCTGGTGTGCGGAGAGCGCGGCTTCTTCTACACGCCCAAGGCCCGCCGGGAGGTGGAGGGCCCCCAGTGCTGTGCCAGCGTCTGCTCGCTCTACCAGCTGGAGAACTACTGTAACTAGGCCTGCCCCCGACACCAATAAACCCCTTGACGAGCCCTGCAAAAAAAAAAA


Sample 3:

CGGGACGAGCTGCACTCGAGGCCGTCAGCAAGCAGGTCCTCGTGCCCCCACCATGGTCCTGTGGATGCGCCTGGTGCCCCTGCTGGCCCTGCTGGCCCTCTGGGCGCCCGCCCCTGCCCGGGCCTTCGTCAACCAGCACCTGTGCGGCTCCCACCTGGTGGAGGCACTGTACCTGGTGTGCGGGGAGCGTGGCTTCTTCTACACGCCCAAGGCCCGCCGGGAGGTGGAGAGCCCGCAGGTGGGGGCCGTGGAGCTGGGTGGAGGCCCCGGTGCAGGCGGCCTGCAGCCCCCGGCCCTGGAGGGGCCCCCGCAGAAGCGCGGCATCGTGGAGCAGTGCTGCACCAGCATTTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAGGGCCCGGC


Sample 4:

error_02_sequencing_ unsuccessful*


Sample 5

CAGCCCTCGGGACGAGCTCACTCGAGGCGTCAGCAAGCAGGTCCTCGTGATGGTCCTGTGGCTGCGCCTTGGGCCCCTGCTGGCCTGCTGGCCCTGCTGGCCCTCTGGGCGCCCGCCCCTGCCCGGGCCTTCGTCAACCAGCACCTGTGCGGCTCCCACCTGGTGGAGGCGCTGTACCTGGTGTGGTGGCTTCTTCTACACGCCCAAGGCCCGCCGGGAGGTGGAGGGCCCGCAGGGCCCGCAGGTGGGGGCCGTGGAGCTGGGTGGAGGCCCCGGTGCCGGCGGCCTGCAGCCCCCGGCCCTGGAGGGGCCCCCGCAGAAGCGCGGCATCGTGGAACAGTGCTGCACCAGCATTTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAGGGCCCGGCGGGCGCCCCCT



*error_02_sequencing_ unsuccessful je chybový výpis sekvenčného zariadenia. Znamená to, že prístroj nebol schopný vzorku sekvenovať, pravdepodobne z dôvodu malého množstva alebo nízkej kvality izolovanej DNA. Žiaľ, znamená to, že nemáte žiadne informácie o géne inzulínu pre vzorku 4.

Vzorka 1-5 Cytochróm C 

Sample 1:

AGAGTACGCGGGGAGACCCAGAAAGCGGGACGTCCGGCCTGCGAGTGGTGGCTTGTCTGTTGAGCTCGGCGAAAGAACGATTTTAAAATGGGTGATGTTGAGAAGGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACTGTAGAAAAGGGAGGCAAACACAAGACTGGTCCAAACCTCCATGGTCTCTTTGGGCGGAAGACAGGTCAGGCTCCTGGATTCTCTTACACAGATGCCAACAAGAACAAAGGCATCACCTGGGGAGAGGAGACACTGATGGAGTACCTGGAGAATCCCAAGAAGTACATCCCTGGAACAAAAATGATCTTCGCTGGCATTAAGAAGAAGGGAGAAAGGGAAGACTTGATAGCTTATCTGAAAAAAGCTACTAATGAGTAAAAGTTGGCCACCGCCTTATTTATTACAAGACCGACGTGTCTCATGACTTTTATATGTGTACCATATTTAAATTGATCTCATACTCTAGAATTCAGATCATGTATGGCTGATGGAATGTTTCTGTTGGATGGTCCTGATTTAAATAAGATTGGTTGGTGGCTAAATGAATATGGTCAGCTGTTTGAATTTTAATATTAATTCTAGTTCAACAAGTACTATCACTGTCTTTCCCTTCTACAGAGATGGTTAAACTTGAATGCGGAGTGTTAAACTTTTCAGGAAAATGGTGAATACCTTCTCAGAACCTATAGGAGATTGGTTTTATATTTAGATTTCTGTAACTGGTTATATTAATATATTTAAATACTGAGAAGATCCCTTCACTGTCTCATAGAACAGAGCAAGATTCACCTGTGTTTCAAGTTGTGTTCACTAGCCTGTTAAGGCATGAGCCAATAGTAAACTGACAGTGTCCCCTTTATCTTTTTGGTCTTAACTATGCCAATTTCATTAAAATTACCTGTATCGAAAATACTGCCTTTTACTTATTGAAAGGTATTTTAGTGAGGTTTATGTACAGCATCAAGTAAAGAGTATTTAGCATTTCTCACATTTTATAGATGATCTTTAAGATCAGAGGCTTTTAAAATTCAGTGTGACGAGATATGTTAGCAGACTTTGCAGGTGAATTCTTACAAGGTCAGGCTGTTAGAATGCAGGATTGTCTTTTAAATAGGTAGTCAGAAACACAACTGTAGAACTCCCGGATGTGTGTGATTGATAATGGTGCTTTTGCCAACTCATGGAAGGCTTAAAGTAGGGGAGCTGTACCATCAGCACAGATTTGTAAATTATCTGGTCATAAAGCTTAAGAATTAAAAACAAAATCACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA


Sample 2:

GGAGCCAGTTTGGTTGCACCAACACCGGTACTTAGGCACGTACCGGCGTGTCCTTGGGCTTAGAAAGCGGGACGTTCGGCTTGTTAGCGGGAACTTCTCGGTCGCGCACAGAGAAAGAACGATTTAAAAATGGGTGATGTTGAGAAGGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCATACTGTGGAAAAGGGAGGCAAGCACAAGACTGGGCCAAACCTCCATGGTCTGTTTGGACGAAAGACAGGTCAGGCTCCTGGATTCTCTTACACAGATGCCAATAAGAACAAAGGTATCACCTGGGGAGAGGAGACGCTGATGGAGTACTTGGAGAATCCCAAGAAGTACATCCCTGGAACAAAGATGATCTTTGCTGGCATTAAGAAGAAGGGAGAGAGGGAAGACTTGATAGCTTATCTCAAAAAAGCTACCAATGAGTAATAGTTGGCCACTGCCTTATTTATTATGAATCAGAAGTGTCTCATGACTTTTTATGTGTACCATATTTAAATTGACTCATATACTAGAATTCAGATCATGAACGGCTGATGGAATAATTCTTTTGGACAGTCCTGATTTAAATAAGATTGGTTTGTGGTTAAACGAATATGGTCAGCTTTTTTAATTTTGATAGTAATTCCGGTTCAACAAGTACTATCATTTTTCCCATTCTAAAGAGATGATTGAACTTGAATAAGGAATATTAAACTTTTTAGGGAGATGGTACATTGCTTCTCAAAACCTATAAGAGATTGGTTTTATATTTAGATTTCTATAACTGGTTATATTAATATATTTAAATACTGAAAAGGTGCCTTCACTGTCTCATAAACAGAGGAGGAGTCACATGTGTTTCAAGTTGTGTTCATTAGCCTGTTAAGGCAAGGATTGAAAATACACTGACAAAGTCCACTTTATCTTTTTGGTTTTATAAACTATGCCAATTTAATTAAAATTCTCTATCTAATAAAAAAAAAAAAAAAA


Sample 3:

GGAGCCAGTTTGGTTGCATTTTCACCCGTACATAGGCGCGGACCGGCGTGTCCTTGGGATTAGAGAGCTGGACGTTTGGCTTGCGAGCGGGGACGGCTTAGTCGTACACGGAGAAAGAACGATTTCGTACACGGAGAAAGAACGATTTAAAAATGTGTGATGTTGAGAAGGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCATACTGTGGAAAAGGGAGGCAAGCACAAGACTGGGCCAAATCTCCATGGTCTGTTTGGGCGAAAGACAGGTCAGGCTGTCGGATTCTCTTACACAGATGCCAACAAGAACAAAGGCATCACCTGGGGTTGGAGAATCCCAAGAAGTACATCCCTGGAACAAAAATGATCTTCGCTGGCATTAAGAAGAAGTCAGAAAGGGCAGACTTGATAGTCAGAAAGGGCAGACTTGATAGCTTATCTCAAAAAAGCTACTAATGAGTAATAGTTGGCCACTGCCTTATTTATTATGAAACAGCTGTCTCATGACTTTTTATGTGTACCGTCAGTGTTTTCCCCTTCTAAAGAGATGATTAAACTTGAATAAGGAATGGTGGCTAAATGAATATGGTCAGCTTTTTGAATTTTGATAGTAATTCTGGTTCAGCAAGTACTGTCAGTGTTTTCCCCTTCTAAAGAGATGATTAAACTTGAATAAGGAATGTTAAACTTTTCAGGGATATGGTGAATGCCTTCTCAAACCCTATAGGAGATTGGTTTTATATCTTTATCTTTTTGGTCTTAAATATGCCAATTTAATTAAAATTCTCCATCTAAAATATTGCGTTTTACTTAATGAAGGGCATTTTAGTGTGGTTTATGTATAGCATCAGATAAAGAATATTTAGTACTTCTCACATTTTAGAGATGATCTTTAAGATCAGATGTTTTTAAAATTCAGCGTTTTACTTAATGAAGGGCATTTTAGTGTGGTTTATGTATAGCATCAGATAAAGAATATTTAGTACTCACATTTTAAAGATGATCTTTAAAGCTCTATCATTAGCACAGATTTGTAAATTATCTGATCATAAGGCTTGAGAATTAAAAACAAAGTCACAGATCAATTATCTGATCATAAGGCTTGAGAATTAAAAACAAAGTCACA


Sample 4:

AGTTCGGTTGCACCAACACCGGTACTTAGGTGCGGACCGGCGTGCCCTTGGATTTAGAGAGCGGGACGTCCGGCTTGCGAGCGGGCACCTTCGTTTCGCGCGCGACGAAAGAGCGGTGAGCGCGCGGCGCGGAGGCCGAAGCGGGAGGGAAGCCGAGCCACGGATTTAAAAATGGGTGATGTTGAGAAGGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCATACCGTGGAAAAGGGAGGCAAGCACAAGACTGGGCCAAATCTCCATGGTTTATTTGGCCGAAAGACAGGTCAGGCCCCTGGATTTTCTTACACGGATGCCAACAAGAACAAAGGCATCACCTGGGGAGAGGAGACACTGATGGAGTATTTGGAGAATCCCAAGAAGTACATCCCTGGAACAAAAATGATCTTCGCTGGCATTAAGAAGACAGGGGAAAGAGCAGACTTGATAGCTTATCTCAAAAAAGCTACTAAGGAGTAATAATTGGCCATTGCCTTATTTATTGCAAAACAAAAATGTGTCATGACTTTTTTTTATGTGTACCGTATTTAAATTGATCTCATACACCAGAATTTGGATCATGAATGGCTGATAGAATATTTCTTTTGGACAGTCCTGATTTAAATAAGATTGGCTTGTGGTTAAGTGAGTATGATCAGCTTTTGAACTCTGATAGTAATTCTGGTTCAGCAAGTGCTATCACTGTTTTCCCCTTCTAAAAATATGATTGGAATTGATTAGTAATGTTCAGCTTTTGACAGAGATGGTAAATGCTATCTCTAAACTTAGATTGGTTTTATATTTAGATACATATAACTTGTTATATTAATATATTTAAATACTGAGGAAACCCCTTCACTGTCTCAGAACCATCAAGACTCAACTGTGTTTCAAGTTGTGTTCGTTAGCCTGTTAAAGGCAAGGGTTGAAGATAAGCTGGCAGTGTCCATTTTATCATTTTGGTCTTAACTATGCCAATTTAATTAAATTCCCTGCATCTAAAATGTTGCCTTTTGCTTAATGAAAGGCATTTTAGTGTGTTTATGTATAATATTAAAGAATATTTAACACTTCTCACATTTTATAGATGATCTGTAAGGTCAGATGCTTTTAAAATTCAGTGTGACGAAATACAGCGGCAGACTTGGCTGGTGAATTCTCTACTAAGTCAGACTAAATTATAATTTAGGATTGTCTTCTAAACAGCTATTCAAAGACACAGCTGTGGAAATACCATATGTGTATGATTGGTAATGGTGCTTTTGCCAACTCGTTAGAAGGGTTAAAATAGAGGAGATATATCATCAGCACAAATTTGTAAATTATGTGATAAGGCTTAAGATGATTAAAAACAAAATCACAGATCATGA


Sample 5:

GGCATTTATCACAGTTTCTCTCAGATATAAACTGTCTGAGGGTAAGGACTTCGTCTTGCTCATCACTGTATTTCCAGCACTGACAAGAGTGCTTATACAGGTAGATACACAAAAAAGATTGTTAAGTGGATGAATATATTCACTGAGTAATTTCCTCCTTTAGACTGTAAGCTTCAAGAGGGTAGGACATTTTATTTTGTTCACTAGAGTATTTCTCAGTGCCTACAGAACCTGGGATATTATAGGTGCTCAATAAACATTTGGTGACTGATGAATTGAATGAATGAGTGAGAAAAGTAGTTTTAAATAAGGATGGAGGCCAGAGTAAGGTCATTTAATAAAGAATTTTATTTGCAATGCTGAGAAGCTTAAATTTTAGACTCCTTGGGGAATTTTAAGCAGGAGAGTGACATATGCAGGCTTACCTTCAATCTAGAAGGATCCCTTCAGCAATTATGTGGAGGATAGTTGGAACATTATAAAGCTATTGCTGTAATATAGGAAAGAGATCAAGCCCTGATACAAGGTAGTTGGAATAGAGAAGACAAATTCAAGGAAATTTAGAAATGCTGTATGTTAGATTAAGATAATGGCTGGATTAAGGTAGGGGAAGAAGGGGAAGAATCTAGCATCACTCCCTGAGTTTCTTATTTGGGAGACCACCTAGAGTAGGCACTCTAAGAAGAAGGGCAGGTTTGGGAGTGAATGAATTTAATTGAGACGTTAATTTTTTTTTAACATGGGAAATCTGGATAATTTTATTGATTTTTGGTAGATTTAGCTGGATTATGGATCTTCTTTTTTTTCTCCCTCACACATACTTAATCCTTTATGTATAAATATACAAAACCTACCACCCCTTGTTTTTTAAGAAACTGATTTGAGTTAAGCAGTTCTTTTACTAGGGACATGTTCCATTTGAGTTTCCTGTGGGATATCCAGGTGGAGATGTACATAGGTAATATGGAGCTCAGTTGAGAAGGTCTGTTTCTGTACTATTCCTTATAATTTCAGTTAAAACAACCTGATGGGCACCAACACCCATACATAGGCGCGAACTGGCGTGTCCTTGGGCTTAGAGAGCGGGACGTTCAGCTTGCGAGAGGGAACCTCTTAGTTGGGTACGGAGAAAGAACGATTTAAAAATGGGTAATGTTGAGAAGGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCATACTGTGGAAAAGGGAGGCAAGCACAAGACTGGGCCAAATCTCCATGGTCTGTTGGGGCGAAAGACAGGCCAGCCTGTCGGATTCTCTTATACTGATGCCAACAAGAACAAAGGCATCACCGGGGGAGAGGAGGCGCTGATGGAGTGTTTGGAGAATCCCAAGAAGTACATCCCTGGAACAAAAATGATCTTCGCTGGCATTAAGAAGAAGGGAGATAGGGCAGACTTGATAGCTTATCTCAAAAAAGCTAATGCGTAATCGTTGGCCACTGCCTTATTTATTATGAAACAAATGTCTCATGACTTTTTATATGTACCATATTTAAATTGATCTCATACACTAGAATTCAGATCATGAATGGCTGATGTAATATTTTTGTCCTGATTTAAATAACGTTGGCTTGTGGCTAAACAAATATGGTCAGCTTTTTGAATTTTGATAGTAATTGCGGTTCAACAAGTACTCTCACTGCTTTCCCTTTCTAAAGAGATGATTAAACTTGAATAAGGAATGTTAAACTTTTCAGGGATATGGTGAAGCCTTCTCAAACCCTATAGGAGATTGGTTTTATATTTAGATTTCTATAACTGATTATATTAATATATTTAAATATTGAGAAGCTCCCTTCACTGTCTCATAGAACAGCAAGAGTCACCTGTATTTCAAGCTGTGTTCATTTGCCTGTTAAAGCAAGGGCTGAAGGTACGATAACAATGTCCACTTTATCTTTTTGGTCTTAAC


Séria 2:  Tajný svet pohlavného života rastlín

Ako si rastliny vyberajú partnera? Na rozdiel od živočíchov sa predsa nemôžu len tak postaviť a rozhliadnuť po vhodnom jedincovi. U väčšiny rastlinných druhov má tá istá rastlina samčie i samičie pohlavné orgány. Niektoré rastliny si zabezpečujú “partnera” tak, že sa jednoducho opelia sami. No mnoho rastlinných druhov je cudzoopelivých - na opelenie potrebujú iného jedinca. Tieto rastliny rozširujú svoj peľ pomocou vetra, vody alebo „presvedčia“ nejaké zviera, aby ho prenieslo na iné rastliny. Musia však vyriešiť ďalší problém: aby sa vyhli samoopeleniu,  musí rastlina vedieť rozlíšiť, či na nej pristál jej vlastný alebo cudzí peľ.

Riešenia zadaní 2. série odovzdajte najneskôr do polnoci 11. decembra.

STEB_SK_Year7_B2_clanok.pdf
STEB_SK_Year7_B2_otazky.pdf
STEB_SK_Year7_B2_projekt.pdf

Séria 3: Výhonky stromu života: ako vznikajú nové druhy

Mnohí z nás ostávajú stáť v úžase nad neskutočnou diverzitou foriem života na Zemi. Vedci odhadujú, že počet druhov na planéte môže byť kdesi medzi niekoľkými miliónmi a ohromným biliónom (veľké rozpätie je spôsobené ťažkosťami pri počítaní bakteriálnych druhov). Čo však druhy vlastne sú a ako vznikajú?

Riešenia zadaní 3. série odovzdajte najneskôr do polnoci 29. januára.

STEB_SK_Year7_B3_Clanok.pdf
STEB_SK_Year7_B3_otazky.pdf
STEB_SK_Year7_B3_projekt.pdf

Séria 4: Vzrušujúci svet génov a ich pôvod I

Genómy rajčiny a mačky divej majú mnoho spoločného, ale nie sú, prirodzene, rovnaké. Hoci zdieľajú časť svojich génov, niektoré gény existujú len v jednom z týchto druhov, ďalšie zas len v druhom. Ako sa to stalo? Čo sú vlastne gény a ako vznikajú?

Majú všetky gény spoločný spoločný pôvod? Môže gén opustiť svoje miesto a pobrať sa preč? Ako spolu súvisia nové gény a nové znaky organizmov?

STEB_SK_Year7_B4_clanok.pdf
STEB_SK_Year7_B4_otazky.pdf
STEB_SK_Year7_4B_projekt.pdf

Sekvencie potrebné na projekt

Alpha 1:

ATGGTGCTGTCTCCTGCCGACAAGACCAACGTCAAGGCCGCCTGGGGCAAGGTTGGCGCGCACGCTGGCGAGTATGGTGCGGAGGCCCTGGAGAGGATGTTCCTGTCCTTCCCCACCACCAAGACCTACTTCCCGCACTTCGACCTGAGCCACGGCTCTGCCCAGGTTAAGGGCCACGGCAAGAAGGTGGCCGACGCGCTGACCAACGCCGTGGCGCACGTGGACGACATGCCCAACGCGCTGTCCGCCCTGAGCGACCTGCACGCGCACAAGCTTCGGGTGGACCCGGTCAACTTCAAGCTCCTAAGCCACTGCCTGCTGGTGACCCTGGCCGCCCACCTCCCCGCCGAGTTCACCCCTGCGGTGCACGCCTCCCTGGACAAGTTCCTGGCTTCTGTGAGCACCGTGCTGACCTCCAAATACCGTTAA 

Alpha 2:

ATGGTGCTGTCTCCTGCCGACAAGACCAACGTCAAGGCCGCCTGGGGCAAGGTTGGCGCGCACGCTGGCGAGTATGGTGCGGAGGCCCTGGAGAGGATGTTCCTGTCCTTCCCCACCACCAAGACCTACTTCCCGCACTTCGACCTGAGCCACGGCTCTGCCCAGGTTAAGGGCCACGGCAAGAAGGTGGCCGACGCGCTGACCAACGCCGTGGCGCACGTGGACGACATGCCCAACGCGCTGTCCGCCCTGAGCGACCTGCACGCGCACAAGCTTCGGGTGGACCCGGTCAACTTCAAGCTCCTAAGCCACTGCCTGCTGGTGACCCTGGCCGCCCACCTCCCCGCCGAGTTCACCCCTGCGGTGCACGCCTCCCTGGACAAGTTCCTGGCTTCTGTGAGCACCGTGCTGACCTCCAAATACCGTTAA 

Beta:

ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAA 

Gamma A:

ATGGGTCATTTCACAGAGGAGGACAAGGCTACTATCACAAGCCTGTGGGGCAAGGTGAATGTGGAAGATGCTGGAGGAGAAACCCTGGGAAGGCTCCTGGTTGTCTACCCATGGACCCAGAGGTTCTTTGACAGCTTTGGCAACCTGTCCTCTGCCTCTGCCATCATGGGCAACCCCAAAGTCAAGGCACATGGCAAGAAGGTGCTGACTTCCTTGGGAGATGCCATAAAGCACCTGGATGATCTCAAGGGCACCTTTGCCCAGCTGAGTGAACTGCACTGTGACAAGCTGCATGTGGATCCTGAGAACTTCAAGCTCCTGGGAAATGTGCTGGTGACCGTTTTGGCAATCCATTTCGGCAAAGAATTCACCCCTGAGGTGCAGGCTTCCTGGCAGAAGATGGTGACTGCAGTGGCCAGTGCCCTGTCCTCCAGATACCACTGA 

Gamma G:

ATGGGTCATTTCACAGAGGAGGACAAGGCTACTATCACAAGCCTGTGGGGCAAGGTGAATGTGGAAGATGCTGGAGGAGAAACCCTGGGAAGGCTCCTGGTTGTCTACCCATGGACCCAGAGGTTCTTTGACAGCTTTGGCAACCTGTCCTCTGCCTCTGCCATCATGGGCAACCCCAAAGTCAAGGCACATGGCAAGAAGGTGCTGACTTCCTTGGGAGATGCCATAAAGCACCTGGATGATCTCAAGGGCACCTTTGCCCAGCTGAGTGAACTGCACTGTGACAAGCTGCATGTGGATCCTGAGAACTTCAAGCTCCTGGGAAATGTGCTGGTGACCGTTTTGGCAATCCATTTCGGCAAAGAATTCACCCCTGAGGTGCAGGCTTCCTGGCAGAAGATGGTGACTGGAGTGGCCAGTGCCCTGTCCTCCAGATACCACTGA 

Delta:

ATGGTGCATCTGACTCCTGAGGAGAAGACTGCTGTCAATGCCCTGTGGGGCAAAGTGAACGTGGATGCAGTTGGTGGTGAGGCCCTGGGCAGATTACTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCTCTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAGGTGCTAGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACTTTTTCTCAGCTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCTTGGGCAATGTGCTGGTGTGTGTGCTGGCCCGCAACTTTGGCAAGGAATTCACCCCACAAATGCAGGCTGCCTATCAGAAGGTGGTGGCTGGTGTGGCTAATGCCCTGGCTCACAAGTACCATTGA 

Epsilon:

ATGGTGCATTTTACTGCTGAGGAGAAGGCTGCCGTCACTAGCCTGTGGAGCAAGATGAATGTGGAAGAGGCTGGAGGTGAAGCCTTGGGCAGACTCCTCGTTGTTTACCCCTGGACCCAGAGATTTTTTGACAGCTTTGGAAACCTGTCGTCTCCCTCTGCCATCCTGGGCAACCCCAAGGTCAAGGCCCATGGCAAGAAGGTGCTGACTTCCTTTGGAGATGCTATTAAAAACATGGACAACCTCAAGCCCGCCTTTGCTAAGCTGAGTGAGCTGCACTGTGACAAGCTGCATGTGGATCCTGAGAACTTCAAGCTCCTGGGTAACGTGATGGTGATTATTCTGGCTACTCACTTTGGCAAGGAGTTCACCCCTGAAGTGCAGGCTGCCTGGCAGAAGCTGGTGTCTGCTGTCGCCATTGCCCTGGCCCATAAGTACCAC 

Zeta:

ATGTCTCTGACCAAGACTGAGAGGACCATCATTGTGTCCATGTGGGCCAAGATCTCCACGCAGGCCGACACCATCGGCACCGAGACTCTGGAGAGGCTCTTCCTCAGCCACCCGCAGACCAAGACCTACTTCCCGCACTTCGACCTGCACCCGGGGTCCGCGCAGTTGCGCGCGCACGGCTCCAAGGTGGTGGCCGCCGTGGGCGACGCGGTGAAGAGCATCGACGACATCGGCGGCGCCCTGTCCAAGCTGAGCGAGCTGCACGCCTACATCCTGCGCGTGGACCCGGTCAACTTCAAGCTCCTGTCCCACTGCCTGCTGGTCACCCTGGCCGCGCGCTTCCCCGCCGACTTCACGGCCGAGGCCCACGCCGCCTGGGACAAGTTCCTATCGGTCGTATCCTCTGTCCTGACCGAGAAGTACCGCTGA 

Séria 5: Vzrušujúci svet génov a ich pôvod II

V druhej sérii o génoch sa pozrieme na ďalšie zaujímavé otázky:

Môžu si živé organizmy navzájom gény požičiavať, alebo darovať? Môže byť gén ukradnutý? Môže zomrieť? Môže gén iba tak zrazu vzniknúť? Čo by sa stalo s bunkou, v ktorej by sa zrazu nový gén objavil? Akým spôsobom vlastne môžeme študovať pôvod génov a ich funkcie?